Quick links to Content
Introduction to Fungal Biology
Morphological Diversity and Life Cycles
Fungal Ecology
Systematics and Fungal Phylogeny
Fungal Molecular Ecology
Adapted Peer Reviewed Literature
Lesson Plans

I. Introduction to Systematic Biology

 

What is systematics?


systematics=taxonomy, the naming and classification of organisms.

systematics provides the language ("handles") that make it possible to discuss biodiversity with precision.

taxonomy uses the Linnaean system of classification (Carolus Linnaeus 1752), which has a nested set of categories (ranks): Kingdom-Phylum-Class-Order-Family-Genus-Species. For example:

K: Fungi

P: Basidiomycota

C: Hymenomycetes

O: Agaricales

F: Amanitaceae

G: Amanita (by convention, genera and species are italicized)

S: A. muscaria. (each species name exists as a binomial, including the genus name and specific epithet)

Ranks, at least those above the species level, are artificial human constructs—they have no inherent biological basis.

Every named group is a taxon (e.g., Fungi, Agaricales, Amanita, etc)

modern biological classifications are structured according to phylogenetic (evolutionary) hypotheses--ideas about the pattern of genealogical relationships that link all organisms.

phylogenetic hypotheses are represented by tree-like diagrams, called phylogenetic trees (also dendrograms or cladograms)

each unique branch of a phylogenetic tree is said to be a monophyletic group (an ancestor and all of its desendants; also called a clade), vs. paraphyletic and polyphyletic groups.

a phylogenetic tree is a nested set of monophyletic groups

modern systematics attempts to make each taxon a monophyletic group--classifications that (attempt to) meet this requirement are called phylogenetic classifications.

the value of phylogenetic classifications has been realized since Darwin's work (1859).

Why are phylogenies and phylogenetic classifications useful?


phylogenetic classifications have predictive value because they group organisms according to recent ancestry.

phylogenetic classifications reflect the process of evolution--the origin and diversification of Life, including convergent evolution and radiation (diversification). Phylogenies can also be used to track the geographic movements of species (biogeography).

Examples—uses of molecular phylogenies:

  1. Multiple origins of the gilled mushroom type morphology.
  2. Independent origins of HIV from viruses of non-human primates.
  3. Geographic origin of West Nile virus.
  4. Correlation of snake phylogeny and antivenom types.
  5. Functional predictions for a gene involved in Alzheimer’s disease.
  6. Prediction of ancestral visual pigment structure, and evolution of light perception.

It is no surprise that the number of molecular phylogenetic studies has risen exponentially in recent years.

How are phylogenies inferred (estimated)?


phylogenies can only be inferred, never "known"

traditionally, phylogenetic hypotheses were derived by intuition, perhaps guided by ideas regarding the "laws" of evolution, perhaps guided by a principle of parsimony (seeking conclusions that require the fewest ad hoc hypotheses)

in modern systematics, phylogenetic hypotheses are created through numerical analyses (phylogenetic analyses) of characters

What kinds of characters are used in phylogenetic analysis?


characters can include virtually any organismal attribute that has a heritable basis.

characters can include: physical form (morphology, anatomy), biochemical characters, behavioral characters, etc. These kinds of characters, for which the genetic basis is not always known, are sometimes lumped together as "morphological" characters.

characters can include: physical form (morphology, anatomy), biochemical characters, behavioral characters, etc. These kinds of characters, for which the genetic basis is not always known, are sometimes lumped together as "morphological" characters.

many phylogenetic characters are now derived from DNA sequence information--these are called "molecular" characters, because the genetic basis is known.

DNA sequences are now the predominant source of phylogenetic characters, but there are other kinds of molecular characters (to be discussed in the next lecture)

What genes are typically used in molecular phylogenetics—and why?


utility of molecular characters depends on their rate of evolution--degree of conservation

the genes encoding ribosomal RNA (rRNA/rDNA) are very popular—why?

nuclear rDNA includes tandemly repeated units of transcribed and non-transcribed

high copy number made it easy to clone rDNA, and get strong signal in Southern blot experiments

rRNA is present in high concentrations in cells—it can be extracted and sequenced directly with reverse transcriptase—this was important before the polymerase chain reaction (PCR) was invented.

rDNA is a mosaic of conserved/variable regions—useful for comparison of organisms that share very ancient or very recent common ancestors

protein-coding genes are also used—highly conserved single copy genes are preferred

redundancy in genetic code means that third positions are most variable; amino acid sequences are more conservative than nucleotide sequences; intron sequences are most variable

Are molecular characters superior to morphological characters for phylogenetic inference?


yes and no….

strengths of molecular characters:

  1. very numerous
  2. allow explicit coding (A/C/G/T)
  3. can be compared in organisms with no morphological similarities
  4. models of evolution based on genetic code and biochemical attributes of DNA can be built into analytical methods

weaknesses of molecular characters:

  1. 1.cannot be obtained from fossils (except very rarely); this is not such a drawback for fungi, which have a poor fossil record
  2. 2.requires expensive laboratory equipment (this becomes less and less significant all the time)
  3. 3.does not provide characters for field identification (this too may change)

molecular and morphological characters can be combined in phylogenetic analyses

most of the approximately 2 million described species have yet to be studied using molecular tools, so in a sense, taxonomy is still primarily based on morphology.

What are the steps in a molecular phylogenetic study?


identify a taxonomic problem—an unresolved question

obtain material and generate DNA sequences. This can be done by collecting material and obtaining new sequences, as we have done, or it is possible to get relevant data by “data mining” from GenBank or other web-accessible data sources (e.g., TreeBASE).

align sequences to each other—this step identifies the specific characters that will be used to infer the phylogenetic tree. Adjacent positions are presumed to be homologous—meaning that they are derived from the same nucleotide position in a common ancestor. Errors in alignment will result in misleading phylogenetic analyses.

perform phylogenetic analysis—yields a phylogenetic tree

Hypothetical alignment (variable positions in bold type):

Species1 ACGTTGACTAACTAGCTAGCTAATCTGA
Species2 ACGTTGACTAACTAGCTAGCTAATCTGA
Species3 ACGTCGACTAACTAGCTAGCTAATCTGA
Species4 ACGTCGACTAACTAGCTA-CTAATCTGA
Species5 ACGTCGACTGACTAGCTA-CTAATCTCA
Species6 ACGTCGACTGACTAGCTA-CTAATCTCA

Continue on to Overview of Laboratory Methods...

 

All content © 2005 AFTOL (Assembling the Fungal Tree of Life Project). Website managed by Jason Slot. AFTOL logo designed by Michal Skakuj. Contact Dr. David Hibbett with any questions. This page was last modified on 08/31/05. Development of this site is being supported by a grant from the National Science Foundation for research in fungal evolutionary biology (NSF award number DEB-0228657).

.